What Role do Women play in the Novel catch 22 by Joseph Heller Essay

What Role do Women play in the Novel catch 22 by Joseph Heller - Essay Example As the same event is often described by different viewpoints, repetition in the novel is an understood phenomenon. However, with the repetition, the writer also allows the reader to understand the characters in a better way. The novel moves ahead with stories at a very fast pace all the time presenting interesting insights into how the characters react to given situations. Just like differing and opposing characters, the situations described in the novel are shared between amusing absurdities and freighting reality. One of those frightful realities is the depiction of women since it is not exactly a flattering image which is given to the reader. Even though the characters played by women are in a minority, they are not exactly powerful and as a matter of fact they are little more than objects for Yossarian and his buddies. As secondary characters in the story, the women influence plot lines and sometimes are a cause for distress to the cast of male characters but they seldom influence the overall feeling of hopelessness and despair present in the novel. Of the female characters, three stand out as prime examples of the situation described above i.e. Nately’s whore, Dreedle’s assistant and Luciana, not because they play significant parts in the storyline of the hero but because they help in bringing about a better understanding of the characters of the men involved in the story. Throughout the novel, women such as General Dreedles assistant, Natelys whore, Luciana etc., give insight on the men who interact with them. Women also figure in secondary roles such as sex workers and rape victims since the times of prolonged war and the devastating effects of World War II certainly reduced the means by which women could make a living and the crimes of war were certainly increased. Morality appears to be a luxury that none of the characters could afford to have. The prostitutes in the story are little more

Factors influencing participation in sport Essay Example for Free

Factors influencing participation in sport Essay Some people have very different views on training and the factors that affect them to participate in sport. They have very different attitudes to training. Im doing climate affecting participation. Some people may want to go out in the rain and train as they may find this enjoyable, but a lot of other people may dislike the cold and wet weather and stay indoors to participate in sport or just sit about. Also the majority of people would rather be outside, but in the warmth, with the sun shining. The countrys climate is a big factor that affects the participation and type of sport that they do, this also affects their attitudes towards training, for example, people in Australia will play more outdoor sports such as windsurfing and skateboarding as their climate is ideal for this type of exercise. Kenya has produced a lot of world class athletes, this is due to their climate, hot and dry all year. This encourages people to train a lot more and also outdoors. Kenya are world class at long distance running as are morocco, this is mostly due to when they train, and what type of weather they train in. If the weather is hot all the time, athletes will train on a regular basis, but if the weather is cold and wet, the athletes will not be motivated enough to go out and train, they will either train indoors or simply just sit around and watch tv or play boardgames. This is the scene in Northern Ireland, and Sweden etc as these countries have unpredictable weather and climates so no one knows what type of day it is going to be. When the weather changes this can change most athletes attitude to training. The heat outside motivates athletes to train outdoors. Fumes from traffic and factories, over a long period of time will start to affect the community in which people live in, this will, in actual fact, bring you bad health. The fumes will bring harm to your lungs and make breathing difficult. This means your fitness level will suffer. The environment also affects your performance in a sport event; for example, on a hot day you can overheat which makes you weak and dizzy. And think what a windy day can do to a tennis match, all these factors affect the performance and attitudes towards the training and participation in sport. At high altitudes air is thinner than at sea level, so you must breath harder in order to get the right amount of oxygen to your lungs. To perform well in a sport at high altitude you must first need time to adapt to the climate and the type of environment you are playing the sport in. All types of weather affect the way in which we think about sport. Hot, cold, dry, wet.

Encoding RIP from Elaeis Guaneensis Jacq

Encoding RIP from Elaeis Guaneensis Jacq Detection and expression profiling of two novel transcripts encoding RIP from Elaeis guaneensis Jacq. in Ganoderma boninense interaction 1. Introduction Among several oil-producing plants, oil palm (Elaeis guineensis) is a tropical crop which is exclusively grown for oil production. Its high oil yield is extracted from oil palm’s thick fleshy mesocarp which is extremely rich in oil (80% of dry mass). Furthermore, oil palm has the highest oil production (oil per unit land) compared to other oil-producing plants. The extracted oil has been used widely for several applications including, food, cosmetics, and bio-fuel (Paterson 2007; Murphy 2009; Alizadeh et al. 2013). Among various diseases , the basal stem rot (BSR) is known to be the most serious disease in oil palm (Ho and Nawawi 1985). Furthermore, the BSR is caused by Ganoderma boninense which is considered specifically as a â€Å"white rot fungus†. The lignin is broken by the fungus leaving whitish cellulose exposed (Paterson 2007). The infection process is initiated when the oil palm roots are penetrated by fungal mycelia, which is spread out to the stem bole, after which the trunk eventually collapses (Rees et al. 2009). Malaysia and Indonesia have suffered the most severe losses from the BSR; furthermore, the diseases has been identified in Malaysia several decades ago (Ho and Nawawi 1985; Idris et al. 2004; Rees et al. 2007). Oil palms of different genetic origins have shown to have resistance to BSR. However, the genes involved in the resistance of oil palms against G. Boninense were unknown (Idris et al. 2004; Durand-Gasselin et al. 2005). Recently, few defence related genes were identified in oil palm. The major pathogen on oil palm in Malaysia has been identified as G. boninense Pat. Stem rots of oil palm caused by species of Ganoderma are a major threat to the sustainability of the oil palm production. In this study, we have isolated one cDNA encoding RIP’s EST, from oil palm. Its expression in oil palm root infected by G. boninese; was investigated to shed light on its potential involvement during early disease development. 2. Materials and methods 2.1 Sample preparation A total of 24 six-month-old oil palm seedlings (Elaeis guineensis Jacq., DxP, GH500 series) were purchased from Sime Darby Plantation Sdn. Bhd. (Banting Malaysia) and divided into two groups with 12 seedlings in each group, one of these groups were treated with Ganoderma boninense Pat. Strain PER71, while the remaining group served as controls. Seedlings treated with G.boninense were inoculated by sitting each seedling on rubber woodblock fully grown with G.boninense PER71 while the other group of seedlings were inoculated with fungal surface mulch as described by (Alizadeh et al., 2011). Three biological replicates of the seedlings were harvested from each treatment at 4, 8, 12 wpi, respectively. The leaves, roots and stem cell were frozen in liquid nitrogen and stored at -80 °C (Tan et al., 2013). 2.2 RNA extraction Total RNA was extracted from treated and untreated oil palm root tissues using a modified CTAB method briefly, 0.1 g tissue was ground in liquid nitrogen into a very find powder. The powder was immediately transferred into 1.5 ml extraction CTAB buffer [ 2% (w/v) cetyl trimethyl ammonium bromide, CTAB; 100mM Tris-HCl, pH 8.0; 2M NaCl; 25 mM ethylenediamineteraacetic acid, EDTA; pH 8.0; 2% (w/v) polyvinylpyrrolidone, PVP; and 2% (v/v) ÃŽ ²-mercaptoethanool]. Equal volume of chloroform/isoamylalcohol (24:1, v/v) was added into the tube and centrifuged at 12,857 g for 15 min at 4 °C. The upper layer was transferred into a new tube and equal volume of phenol/chloroform/isoamylalcohol (25:24:1, v/v/v) was added and centrifuged. This step was repeated until a clear supernatant was obtained. The supernatant was adjusted to a final concentration of 2M LiCl, and incubated at 4 °C for overnight, and then centrifuged. The RNA was dissolved in 5ml diethypyrocarbonate (DEPC) – treated water. An equal volume of chloroform/isoamylalcohol was added, mixed, and centrifuged at 12,857 for 30 min at 4 °C. Precipitation of RNA was performed by adding 0.1 vol of 3M sodium acetate (pH 5.2), 2 vol 100% ethanol and incubated at -80 °C for overnight. After centrifugation, the pellet was washed using 70% ethanol and dissolved in 20ul DEPC-treated water. The quality of RNA was examined by using a Nanodrop( BioRad) at 230, 260 and 280 nm. The RNA integrity was examined using 1.5% agarose gel electrophoresis. The RNA was treated with DNase I (Qiagen, USA) following the manufacturer’s instructions. Figure : Total RNA from various treated and untreated oil palm tissues. Lane A: Untreated control seedling. Lane B: Treated seedlings. 1) Leaf. 2) Basal stem. 3) Root 3. Semi-quantitative Reverse transcriptase (RT-) PCR 3.1 Isolation of cDNA Omniscript â„ ¢ Reverse Transcriptase kit (Qiagen Kit) was used for cDNA synthesis by the following kit manuscript. To obtain the sequence of cDNA from oil palm, gene specific primers were designed based on oil palm expressed sequence tag (EST) (Ho, 2010) and RIP’s type I alignments, using primer 3 version 0.4.0(frodo.wi.mit.edu). 3.2 Sequence analysis of cDNA Semi-quantitative Reverse transcriptase (RT-) PCR was performed on EST using PCR machine with Reverse transcriptase enzyme. Equal amounts of RNA (1ug) extracted from control and treated oil palm root samples were converted into cDNA by using the Omniscript two step Reverse Transcription Kit for cDNA Synthesis (Qiagen, USA) following the manufacturer’s instructions. The resulted sequences shown significant similarities to RIP (Naher et al., 2011). 3.3 Expression profiling Expression levels were calculated by Quantity One 1-D Analysis software 4.6.5 (Bio-Rad) according to the manufacturer’s instructions. PCR products were resolved on 1.5%(w/v) agarose gel (1xTAE) with a DNA mass standard marker (MassRuler TM DNA Ladder, Fermentas). The density of the DNA mass standard dilution series was used to generate calibration curve for absolute quantisation of sample bands by linear regression with extrapolation to zero for each experiment. The density of each sample band was then converted to an absolute quantity using the calibration curve. For each sample band was then converted to an absolute quantity using the calibration curve. For each experiment, the relative band quantity obtained by densitometrric analysis was normalized to the value of the internal control (house-keeping gene) bands which were run in parallel. Identification of differentially expressed genes was based on consistent ford-change across experimental replicates relative to untreate d negative control. Fold changes of ≠¥2- fold or ≠¤0.5-fold were considered as significant. 3.4 Statistical analysis A one-way analysis of variance (ANOVA) was used to determine statistical differences (SPSS version 17;SPSS Inc., Chicago, IL). When the ANOVA was significant at P 0.05 the Duncan’s multiple range test was used for means comparison. The t-test was used to compare between group means.(Alizadeh et al., 2011) 4. Results 4.1 sequence analysis EgRIP-1b The partial cDNA of EgRIP-1b (Dr. Ho personal comment) encodes a putative type I ribosome inactivating protein. The partial sequence consists 167 nucleotide residues. (Fig. 2). This sequence has the highest identity with RIP type I from Populus trichocarpa (98%, XP_002328056.1), Hordeum vulgare (90%, AAA32951.1) and Chain A, Structure Of Mutant Rip From Barley Seeds (90%, 4FBA_A). The NODE_77734GT was classified in a RIP-like superfamily. A putative conserved domain of catalytic residues and some RIP family domain were in this sequence, including that it is a member of the RIP superfamily.(Fig. 5) (Naher et al., 2011) M I C E S I R F E R I S E F L A T E F P G S S K P P K TGATGATCTGCGAGTCGATTAGATTCGAACGCATCTCCGAATTTCTTGCTACCGAATTCCCCGGCAGTTCGAAACCCCCTAAA W M P A L E H G W G D L S A A L L R A D A N P D R P F TGGATGCCGGCACTCGAGCACGGCTGGGGAGATCTCTTTGCCGCGTTGCTGCGCGCCGATGCCAATCCCGACCGTCCCTTCA Fig. 2. The nucleotide and deduced amino acid sequences of NODE_77734GT. 4.2 sequence analysis EgRIP-1a The partial cDNA sequence EgRIP-1a (GenBank ID: ) encodes a protein of 17 amino acid. The sequence consists 178 nucleotides (Fig. 3). This sequences has the highest identity with other type I RIPs from Nicotiana tabacum (47%, ABY71831.1), Musa acuminate (47%, ABY71832.1), Alocasia macrorrhizos (47%, ABY71829.1), Agave sisalana (47%, ABY71828.1) (Fig. 6.a) and (Fig. 6.b) M R P T P N F H Y E W S A CAGGATTCCAGCCGAGCTCCTGCGATAGCCGAACTTCTACCACATGCGACCTACTCCAAACTTCCACTACGAGTGGTCTGCTC L S K Q TCTCCAAACAA Fig. 3. The nucleotide and deduced amino acid sequences of EgRIP-1a. Fig. 4: multiple alignment of NODE with other type I RIPs. Amino acid residues that are identical in all sequences are highlighted in black while amino acid residues that are highly conserved are highlighted in gray; dashes represent gaps introduced to maximize the alignment. (a) (b) Fig. 5: Multiple alignment of EgRIP-1a with other RIPs. The protein sequences and their accession numbers used for analysis of detected sequence. a) Nucleotide residues that are highly conserved are highlighted in gray; dashes represent gaps introduced to maximize the alignment. b) Amino acid residues that are identical in all sequences are highlighted in black with amino acid residues that are highly conserved are highlighted in gray; dashes represent gaps introduced to maximize the alignment. 4.3 Expression profiles (of RIP) in oil palm root upon Ganoderma inoculation A total of 2 cDNA sequences encoding putative defence-related proteins from oil palm were chosen for gene expression profiling in this study. A relative semi-quantification of EgRIP-1b and EgRIP-1b transcripts were performed by calibrating the expression of each gene with an endogenous control, actin. Fig.6 Shows the relative expression level of EgRIP-1b in roots and basal stems in response to the inoculation of G. boninense at different time points compared with that of negative control plants. In G. boninense-treated plants, the gene expression of EgRIP-1b in oil palm roots at 2 wpi was induced. The expression level were n- and n-fold of the uninfected root tissues at 8 and 12 wpi, respectively.(Naher et al., 2011) The expression level was studied in 3 replication of each sample, there were no significant (P>0.05) differences in expression levels in inoculated plants (Alizadeh et al., 2011). EgRIP-1a was up-regulated n-fold and n-fold at X wpi, respectively; before the transcript level decrease at Y wpi in oil palm root tissue following G.boninense infection (Fig). EgRIP-1a expression level were m-, m- and m-fold of the uninfected basal stem tissues at 2,4, 8 and 12 wpi, respectively. EgRIP-1b and EgRIP-1a were not expressed in time zero, untreated samples and leaf tissues. (I) diseased (II) healthy (a) (b) (c) Fig. 6. Differential expression of EgRIP-1b in variety tissues in response to I) G.boninese treatment compare to those in II )control.. a) root tissue, b) stem cell tissue, c) standard (Rippmann et al., 1997) a) b) Fig. 7. Expression level mean in each biological replicate a) in root; b) in stem (I) diseased (II) healthy (a) (b) (c) Fig. 8. Differential expression of EgRIP-1a in variety tissues in response to I) G.boninese treatment compare to those in II) control.. a) root tissue, b) stem cell tissue, c) leaf tissue d)control (Rippmann et al., 1997) a) b) Fig. 9. Expression level mean in each biological replicate a) in root; b) in stem Fig. 10. Semi-quantification of oil palm EgRIP-1a and EgRIP-1b expression levels in root tissues at 2-12 week after inoculation with G.boninense. Significant up-regulation of gene expression compared to untreated negative control. References Alizadeh F, Abdullah SNA, Chong PP, Selamat A Bin (2013) Expression Analysis of Fatty Acid Biosynthetic Pathway Genes during Interactions of Oil Palm (Elaeis guineensis Jacq.) with the Pathogenic Ganoderma boninense and Symbiotic Trichoderma harzianum Fungal Organisms. Plant Molecular Biology Reporter. doi: 10.1007/s11105-013-0595-y Durand-Gasselin T, Asmady H, Flori a, et al. (2005) Possible sources of genetic resistance in oil palm (Elaeis guineensis Jacq.) to basal stem rot caused by Ganoderma boninenseprospects for future breeding. Mycopathologia 159:93–100. doi: 10.1007/s11046-004-4429-1 Ho YW, Nawawi A (1985) Ganoderma boninense Pat . from Basal Stem Rot of Oil Palm ( Elaeis guineensis ) in Peninsular Malaysia. Pertanika 8:425–428. Idris AS, Kushairi A, Ismail S, Ariffin D (2004) SELECTION FOR PARTIAL RESISTANCE IN OIL PALM PROGENIES TO Ganoderma BASAL STEM ROT. Journal of Oil Palm Research 16:12–18. Murphy DJ (2009) Oil palm: future prospects for yield and quality improvements. Lipid Technology 21:257–260. doi: 10.1002/lite.200900067 Paterson R (2007) Ganoderma disease of oil palm—A white rot perspective necessary for integrated control. Crop Protection. doi: 10.1016/j.cropro.2006.11.009 pilotti CA (2005) Stem rots of oil palm caused by Ganoderma boninense: Pathogen biology and epidemiology. Mycopathologia 159:129–137. Rees RW, Flood J, Hasan Y, et al. (2009) Basal stem rot of oil palm ( Elaeis guineensis ); mode of root infection and lower stem invasion by Ganoderma boninense. Plant Pathology 58:982–989. doi: 10.1111/j.1365-3059.2009.02100.x Rees RW, Flood J, Hasan Y, Cooper RM (2007) Effects of inoculum potential, shading and soil temperature on root infection of oil palm seedlings by the basal stem rot pathogen Ganoderma boninense. Plant Pathology. doi: 10.1111/j.1365-3059.2007.01621.x Tan Y-C, Yeoh K-A, Wong M-Y, Ho C-L (2013) Expression profiles of putative defence-related proteins in oil palm (Elaeis guineensis) colonized by Ganoderma boninense. Journal of plant physiology. doi: 10.1016/j.jplph.2013.05.009

The Effects of Occupational Stress on Physical Health and its Consequen

No matter the job, stress will always play a role in an individual’s life. Regardless of whether one is a waitress, a teacher, a corrections officer, or a doctor, avoiding stress in the workplace is nearly impossible, perhaps even impossible. And the effects of stress in the workplace are numerous. Stress can have both psychological and physical effects on the members of the workforce. And while the specific effect may differ from one individual to the next, and in particular the effect on physical health will certainly differ from one job to another, a construction worker will most certainly experience different health issues than a secretary, for instance, physical health. Research conducted in the field of occupational health psychology has found evidence linking health and mortality in individuals to the stress encountered in the workplace; in particular research has discovered a causal effect between work experiences and physiological responses (Macik-Frey, Quick & Ne lson, 2007). Stress in the workplace can have an effect not only on the safety measures employees engage in while on the clock, but can also affect how an individual behaves outside of the workplace, in fact, it is not uncommon for an individual to experience accidents and injuries outside of the workplace that can be linked back to the stresses they experienced not only in the workplace but other stresses concerning one’s employment (Macik-Frey et al, 2007). Estimates vary widely on the cost to organizations of poor health in employees, with some estimates reporting losses in the billions of American organizations, not only from the loss of productivity and sick-leaves, but also as a result of caring for these illnesses. Cardiovascular heart-disease (CDH... ...lsewhere, or they may just have no causal link. In the study of burnout and physical health, there is still much more research necessary to fully understand and prevent not only burnout, but cardiovascular disease, particularly in the workforce. The link is not always certain, but with new researches conducted the pathway between burnout and cardiovascular disorder, between stress as a whole and physiological symptoms, becomes clearer. The benefit is not only for mental health but also physical well-being of employees and overall increased production in organizations; it is not just the individual who benefits from burnout treatments in their well-being and overall job satisfaction, but the organization benefits from having a healthy workforce who are also happy, or at least not frustrated and dissatisfied, with their occupation and position in the organization.

Psychology of Human Sexuality

65 million people are living with an incurable STI (Sexually Transmitted Infection) in the United States. This is an extremely high number which includes many different types and forms of diseases. Some are curable and others are not. So this is a huge problem in the USA and all over the world that I had no idea about or put much thought into. It is incredible the outstanding number of people with STI’s and the growing rate. This truly is in every sense of the word a pandemic as referred to in the book. I will discuss a few things from this chapter about STI’s that I found most interesting besides the STI’s themselves that almost made me hurl due to some of the graphic pictures. Some issues that are related and need to be learned include the lack of symptoms, lack of accurate information, unhealthy sexual emotions and attitudes, poor sexual communication, and substance abuse and its relation to STI’s. All of the above mentioned things I will discuss are important to me because they are risk factors that I needed to learn and be aware of. For example, not all STI’s have symptoms or show signs of physical problems such as rashes or a discharge. Most sexual transmitted infections have symptoms that are often absent. That is scary due to the fact people may not know they are infected and maintain their normal sexual activity with no knowledge of infecting others. This is a huge problem to me because it’s not like people carry their results with them of their last STI test results. In my case I get tested in 3 days due to the fact ignorance is bliss and I don’t want to be irresponsible in my actions. I also think that some people don’t get tested for the mere fact they just don’t want to know even if they have been involved in risky sexual behaviors. Asymptomatic means that symptoms may not be produced at all. Not know if you are infected and affecting others leads to a bigger problem because most STI’s leads to greater health problems down the road. A sexual act of of love or lust can turn into a nightmare. Lack of knowledge is a huge risk factor because the number of our youth participating in sexual activities is indeed increasing. They partake in oral sex and think it is ok because pregnancy can’t occur. However, being one of these ignorant kids’ years ago myself I didn’t know that oral sex increases the chances of STI’s or what an STI was. Especially, these hormone and sexually driven kids don’t care or have the knowledge of knowing the ease at which STI’s can spread through sexual activity and oral sex, or even the lack of knowing how severe this problem can occur. I’ve heard a lot of my friends say oh man I just got tested after I hooked up with that slut and I’m clean, guess I dodged a bullet. It is a complete joke and the severity of these issues is not driven home properly. Sexual emotions and attitudes are something I have learned to be true. I know a lot of girls who were told sex is bad by their parents and they seemed to take it out on their college exploits. Avoiding the safe sex talk and that sex is not a horrible thing when handled correctly can lead to better understanding and decision making by the child. Also, the the fear and stigma of people who have STI’s or don’t want to be tested for fear they might have one creates more issues for them and may lead to them not telling their partner out of shame and embarrassment. This I thought I knew but this chapter justified that thought. I for sure learned that sexual communication is important for a healthy sexual relationship. It is healthy for my relationship and makes things more comfortable and easy. I learned that not just condoms and knowledge are important in preventing STI’s, but communication has an essential role as well. Parents must discuss safe sex with their children and openly discuss sexual matters due to the fact it is normal eventually inevitable. Talking to your partner about being tested or that you have an STI is the responsible thing to do. I knew that substance abuse had to play a role in increasing the chances for the spread of STI’s. it only makes sense due to the fact we all know what it feels like to be under the consumption of alcohol where our morals and principles go at that point. Things become more in the moment as mentioned in the book and risky sexual behavior is more likely to occur. For example, I know a lot about this from attending San Diego State University a big party school in California, but the statistics provided in the book that 1 in 5 teens reports having unprotected sex while under the influence of drugs and lcohol just solidifies that theory. I learned a lot and was shocked about the STI pandemic and all the issues related such as the lack of information and health risks associated with it. This really does scare me to know that my previous partners could have unknowingly passed an STI to me. I was tested before my girlfriend and I started dating but I will get tested again in three days just to be sure. It is really important to do so and people should be made aware of the severity and problems related to STI’s followed by knowledge and prevention methods. I am thankful for this class and my newfound knowledge.

Origin of the Cold War Essay

For more than four decades, world politics revolved around the Cold War. The foreign policy of both the United States and Soviet Union was dominated by the Cold War with far reaching social, political, economic and military consequences. The domestic politics and foreign policy of other nations around the world was also shaped by the Cold War. Very few countries escaped its influence. Since the distinctive features of the Cold War era was shaped in the years that immediately followed the Second World War, an analysis of its origin is important in understanding international history in the second half of the twentieth century. There are various conflicting interpretations of the origin of the Cold War. These interpretations are often based in deep philosophical and ideological differences. A great majority of these interpretations were themselves structured by the ongoing Cold War. The end of the Cold War together with the release of important information over the past years has provided an opportunity to reassess its origins. The earlier controversies concerning the responsibility of the Cold War can now be transcended in an attempt to understand what happened and why. New questions concerning the origins of the Cold War can now be asked. In this paper, I will focus on the international system and the events in the United States as recounted by Kissinger. Kissinger analyzes geopolitics and the perception of threat, ideology and social reconstruction, and strategy and technology. He examines how the American perceptions of national security interests were influenced by global distribution of power and deeply ingrained ideological predispositions. He also demonstrates how the need for hegemony helped shape the political conditions of other nations. There are two dominant views concerning the outbreak of the Cold War. The first is the view that the Soviet Union was mainly responsible for the outbreak. This view pictures the Soviet Union as persistently expansionist and being motivated ideologically. According to this perception, the United States authority wanted to get along with the Soviets. However, they realized that accommodation was not possible since the Soviet authorities quested for world domination. The second view is that the policies of the United States were also expansionist and therefore contributed to the beginning of the Cold War. The idea points towards the long history of American expansionism and argues that United States policies were shaped by ideological beliefs and economic interests to a large extent. It is this second idea that I wish to explore in the writing of Kissinger. The American foreign policy until the early into the twentieth century was characterized by isolationist tendency. According to Kissinger (29), the rapidly expanding power of the United States and the gradual collapse of international system that was previously centered in Europe projected the United States into world affairs. There was wide recognition by the United States administrations during this era that America had an important role to play in world affairs. The international balance of power could not be conceived by American leaders without the role of the United States. There was a deep philosophy that underlay this idea; America had an obligation to spread its principles throughout the world (Kissinger 30). The rise of new powers had been vehemently fought by European powers. The United States was however confident that they could resist any challenge. The American foreign policy was crafted on the conviction that the constant wars that were being fought in Europe were consequences of Europe’s cynical methods of statecraft (Kissinger 32). Ingrained in the American thought was the idea that peace depended on the promotion of democratic institutions. America saw it her responsibility to spread this idea. A great majority of American leaders were convinced that the United States had a special responsibility to spread its values in order to foster world peace. American foreign policy was radically transformed by Roosevelt who strongly believed that America was a great power. He also believed that in a world regulated by power, the natural order of things was reflected in the concept of spheres of influence (Kissinger 40). He was committed to engaging America to reestablish the equilibrium. He saw Germany and Russia as posing a threat to United States dominance in Europe and Asia respectively. He particularly saw Russia as holding in her hands the fate of the coming years. It is during this era that the United States begun seeing Russia as a possible threat to her interests. Weakening of Russia thus became a major issue. The United States saw itself as solely responsible for the security of the entire mankind. This perception foreshadowed its containment policy that was later developed after the Second World War. These sentiments obviously rubbed any nation that desired dominance the wrong way, invariably resulting ion conflict. With the Soviet Union having its own philosophy, the result would not have been anything apart from the Cold War. Work Cited Kissinger, Henry. Diplomacy. Simon and Schuster.